One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?
Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU