Would you expect the dna or cdna of a eukaryotic gene
Problem: What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer (i.e. have a greater number of nucleotides)? Why?
Expected delivery within 24 Hours
When was the first time you saw pornographic material? What was it? How did it affect you? (3 complete sentences or more)
1. Discuss how you will manage new founders. 2. Discuss whether you should create artificial emigration and immigration for different facilities.
Larry's brother Barry also had muscular dystrophy but neither of their parents had the disorder. Draw a pedigree:
Describe and Differentiate between discrete traits and quantitative traits. Describe how a chi-square test is used in Genome-wide association studies.
What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer
What is a "gene knockout" in a mouse? Briefly describe one method scientists currently use to knockout genes in mice.
A) What is the genotype frequency of GG? B) What is the genotype frequency of Gg? C) What is the allele frequency of the "g" allele?
Problem: The DNA fragment CGTCATCGATCATGCAGCTC contains a restriction enzyme recognition site. Identify the site.
A random sample of 1000 kernels revealed that 870 were yellow. Find the allele frequency estimates for this population.
1929320
Questions Asked
3,689
Active Tutors
1460877
Questions Answered
Start Excelling in your courses, Ask a tutor for help and get answers for your problems !!
Which form of association with alcohol/drugs with violent crime describes crimes that may be committed to support a drug habit?
Post an example of a time when you complied with an authority person's demand, despite thinking it was not a good use of your time.
Which one habit, if replaced with a more intentional alternative this week, would have the most significant positive impact on both your energy
if you share something unusual, explain why this would be an unexpected part of your gender identity.
John moves to a new job in a large urban area. For the first few days, John is continuously distracted by the sounds of traffic and street noise.
In a famous series of experiments conducted by Harry Harlow, infant monkeys were separated from their mothers at birth.
In the Strange Situation experiment, infants who were classified as securely attached were more likely to do which of the following?