Would you expect the dna or cdna of a eukaryotic gene
Problem: What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer (i.e. have a greater number of nucleotides)? Why?
Expected delivery within 24 Hours
When was the first time you saw pornographic material? What was it? How did it affect you? (3 complete sentences or more)
1. Discuss how you will manage new founders. 2. Discuss whether you should create artificial emigration and immigration for different facilities.
Larry's brother Barry also had muscular dystrophy but neither of their parents had the disorder. Draw a pedigree:
Describe and Differentiate between discrete traits and quantitative traits. Describe how a chi-square test is used in Genome-wide association studies.
What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer
What is a "gene knockout" in a mouse? Briefly describe one method scientists currently use to knockout genes in mice.
A) What is the genotype frequency of GG? B) What is the genotype frequency of Gg? C) What is the allele frequency of the "g" allele?
Problem: The DNA fragment CGTCATCGATCATGCAGCTC contains a restriction enzyme recognition site. Identify the site.
A random sample of 1000 kernels revealed that 870 were yellow. Find the allele frequency estimates for this population.
1933500
Questions Asked
3,689
Active Tutors
1451628
Questions Answered
Start Excelling in your courses, Ask a tutor for help and get answers for your problems !!
1. Discuss the impact of play and care on development in toddlers. 2. What did you learn from this study?
What findings, in the evaluation of deceased or injured drivers involved in a front impact motor vehicle collision, may be helpful in determining
What are some of the ways we distinguish between a moving head injury vs a situation where a moving object impacts a stationary head?
How would you determine if a boundary-crossing or dual relationship is ethical and appropriate? What criteria would you consider when making your decision?
If Darla tells her supervisor, and her supervisor does not act on her concerns, what are the ethical and legal implications?
Describe how an ethical counselor addresses issues of professional competence in his or her own practice.
Briefly describe at least two commonly used public relations "programming" activities. Include in your description a situation in which each activity would