Would you expect the dna or cdna of a eukaryotic gene
Problem: What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer (i.e. have a greater number of nucleotides)? Why?
Expected delivery within 24 Hours
When was the first time you saw pornographic material? What was it? How did it affect you? (3 complete sentences or more)
1. Discuss how you will manage new founders. 2. Discuss whether you should create artificial emigration and immigration for different facilities.
Larry's brother Barry also had muscular dystrophy but neither of their parents had the disorder. Draw a pedigree:
Describe and Differentiate between discrete traits and quantitative traits. Describe how a chi-square test is used in Genome-wide association studies.
What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer
What is a "gene knockout" in a mouse? Briefly describe one method scientists currently use to knockout genes in mice.
A) What is the genotype frequency of GG? B) What is the genotype frequency of Gg? C) What is the allele frequency of the "g" allele?
Problem: The DNA fragment CGTCATCGATCATGCAGCTC contains a restriction enzyme recognition site. Identify the site.
A random sample of 1000 kernels revealed that 870 were yellow. Find the allele frequency estimates for this population.
1925641
Questions Asked
3,689
Active Tutors
1417606
Questions Answered
Start Excelling in your courses, Ask a tutor for help and get answers for your problems !!
How did WWII challenge, transform, and reinforce race, class or gender roles (select one area; you do not need to write on all three)?
Compare and contrast the civilizations of Mesopotamia and Egypt. Do this in terms of geography as well as political and intellectual outlook.
World War II had a profound impact on gender roles, challenging traditional norms and opening up new opportunities for women in the workforce.
Describe the idea of Henry Clay's "American System." Analyze the role of mechanization and communication in the American System.
Select a work of art from the Metropolitan Museum of Art collection. Please do not select one that has already been chosen by a classmate.
discuss how the new oil painting technique developed in the early fifteenth century influenced how artists communicated their vision of the world?
Examine and discuss Cold War policy under the Truman and Eisenhower administrations. How did these administrations seek to combat the spread of communism abroad