Would you expect the dna or cdna of a eukaryotic gene
Problem: What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer (i.e. have a greater number of nucleotides)? Why?
Expected delivery within 24 Hours
When was the first time you saw pornographic material? What was it? How did it affect you? (3 complete sentences or more)
1. Discuss how you will manage new founders. 2. Discuss whether you should create artificial emigration and immigration for different facilities.
Larry's brother Barry also had muscular dystrophy but neither of their parents had the disorder. Draw a pedigree:
Describe and Differentiate between discrete traits and quantitative traits. Describe how a chi-square test is used in Genome-wide association studies.
What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer
What is a "gene knockout" in a mouse? Briefly describe one method scientists currently use to knockout genes in mice.
A) What is the genotype frequency of GG? B) What is the genotype frequency of Gg? C) What is the allele frequency of the "g" allele?
Problem: The DNA fragment CGTCATCGATCATGCAGCTC contains a restriction enzyme recognition site. Identify the site.
A random sample of 1000 kernels revealed that 870 were yellow. Find the allele frequency estimates for this population.
1955316
Questions Asked
3,689
Active Tutors
1420867
Questions Answered
Start Excelling in your courses, Ask a tutor for help and get answers for your problems !!
The belief that the misinformation effect results from instances where the original memory is replaced with a new, incorrect memory
Question: A profiler concludes the offender is socially isolated based solely on a single disorganized crime scene.
During a serial burglary investigation, analysts construct a geographic profile suggesting the offender lives within a certain radius of crime scenes.
A police department adopts a new offender profiling system that has impressive success stories but lacks peer-reviewed validation.
Question: A forensic psychologist's opinion is excluded in court because it lacks scientific validity.
How will the attitudes of the family you grew up in impact you as a counselor? What about the ones you have now?
Summarize: Adam participated in an individualized functional analysis to identify some of the variables related to his aggression, tantrum