Discussion about restriction enzyme recognition site
Problem: The DNA fragment CGTCATCGATCATGCAGCTC contains a restriction enzyme recognition site. Identify the site.
Expected delivery within 24 Hours
Describe and Differentiate between discrete traits and quantitative traits. Describe how a chi-square test is used in Genome-wide association studies.
What is cDNA? How is it useful when attempting to "clone" a gene? Would you expect the "DNA" or "cDNA" of a eukaryotic gene to be longer
What is a "gene knockout" in a mouse? Briefly describe one method scientists currently use to knockout genes in mice.
A) What is the genotype frequency of GG? B) What is the genotype frequency of Gg? C) What is the allele frequency of the "g" allele?
A random sample of 1000 kernels revealed that 870 were yellow. Find the allele frequency estimates for this population.
Is it possible for the man to pass colorblindness to his daughters? It is possible for the man to pass colorblindness to his son?
Problem: What happen when council of higher education accreditation contact you or find out of cheating?
If a disease determined by autosomal recessive heredity occurs at a frequency of 0.04 in a population, what is frequency of this disease allele in population?
1946227
Questions Asked
3,689
Active Tutors
1448385
Questions Answered
Start Excelling in your courses, Ask a tutor for help and get answers for your problems !!
Provide examples of differences in verbal and nonverbal communication methods within this religion.
Appraise economical aspects that influence healthcare delivery systems. Scenario: Your hospital received $4,000,000 in revenue this past year.
Identify one goal for the semester related to your personal self-awareness and growth.
Post a brief description of the situation you experienced and explain how incorporating or not incorporating patient preferences
Share an insight from having read your colleagues' postings, synthesizing the information to provide new perspectives.
A brief overview of the plan for implementing the strategy/intervention in the practice setting - include in the plan the resources
In what ways can nursing theory shape nursing education to better prepare nurses for culturally proficient care?