What allele number would represented by chromosome two, Biology

+44 141 628 6080
[email protected]

What allele number would represented by chromosome two

Problem

The tetra-nucleotide short tandem repeat AATG is observed numerous times at the THO1 locus in both chromosomes of a DNA sample. Using this information, what allele number would be represented by chromosome 1, and what allele number would represented by chromosome 2?

Chromosome 1: AATGAATGAATGAATGAATG

Chromosome 2: AATGAATGAATGAATGAATGAATGAATG

View Complete Question

Request for Solution File

Ask an Expert for Answer!!

Biology: What allele number would represented by chromosome two

Reference No:- TGS03274091

Expected delivery within 24 Hours

Have a Question? (oR Write a Review)

Write atleast 100 words!!

Asked Questions

Discuss social worker working with foster children

You are a social worker working with foster children. You are making a home visit to Katie, age nine, and her foster family.

Identify a specific theory of cognitive or moral development

Problem 1: Identify a specific theory of cognitive or moral development, and summarize the major assumptions.

Problem on journal articles and non-journal materials

Amanda said? Excellent post, Chrystal. You provided great insight into the helpful resource ERIC digital library is. I appreciate how it states the information

Problem concerning consensual sexual relationship

Question: Jena and Ben are employees of Big City Electronics. They began to have a consensual sexual relationship.

Describe the results, including any scores

Describe the results, including any scores. Result: E6% Extraverted Action oriented, Outgoing, Expressive, Hands-On S17% Sensing Traditional,

Problem regarding the america youth and social media

Think about where you were the most and least engaged when reading a classmate's draft. Think about what captured your attention

What is a behavioral indicator related to family

Which of the following is a behavioral indicator related to Family? A) Developing school readiness and transition strategies B) Developing collaborative

Request for Solution File

Ask an Expert for Answer!!

Biology: What allele number would represented by chromosome two

Reference No:- TGS03274091

Have a Question? (oR Write a Review)

Recent Questions Asked Biology

Q : How john gottman explain what is happening with grant

Q : Do you agree about her views on women and aging in the media

Q : What advice you give for the experiences of love

Q : Explain ethical theories of ruth benedict-james rachels

Q : What allele number would represented by chromosome two

Q : Which you prefer individual or group counseling and why

Q : How people develop emotional connections with one another

Q : Which organism would require a higher temperature

Q : How transparent was freud with the world