Start Discovering Solved Questions and Your Course Assignments
TextBooks Included
Solved Assignments
Asked Questions
Answered Questions
Explain DNA sequencing with reference to the cloning of a DNA fragment in bacteriophages M13 based cloning vector.
One of these dogs ate some of a birthday cake. Digestion and electrophoresis of DNA found at the scene of the crime with the restriction enzyme Scs1 revealed a banding pattern included of four band
Describe why a woman carrying the gene for hemophilia can generate two hemophiliac sons when she is mated to a normal male.
You failed to recover any revertants from mutants A and recovered one revertant from mutant B. This revertant was crossed with a normal wild-type strain. What proportion of the progeny from this cro
Describe the impact of chromosomal aberration during the Meiosis II, when the normal gametes produced as an end product of Meiosis II are compared with those produced from Meiosis II with the chromo
I have utilized a polyacrylamide gel in a protein analysis of fish samples. My question is why this is employed rather than an agarose gel.
Would it be possible to investigate the possible homology between the Y chromosome on an animal (example: platypus) and the Y chromosome on a human - using FISH (fluorescent in situ hybridization)?
Eukaryotic genes differ than the prokaryotic genes. Please describe, in depth, the post-transcriptional modification which a eukaryotic mRNA goes through before it leaves the nucleus and explain how
Is it possible for two people who have Down syndrome to give birth to a normal (without Down syndrome) child? If so, explain how would that be possible?
Select a chromosomal disorder from the March of Dimes Foundation Website. Recognize the disorder and describe how is it expressed in a person and inherited.
Certain trees of the similar species are known to take place with some different chromosome numbers, even although they have similar features.
What would occur if any of the gametes produced were crossed with any of the other gametes produced? (That is, crossing an abnormal gamete with the normal gamete)? Be specific.
Suppose that a single gene controls soybean seed color, and that you already know the nucleotide sequence of the wild type allele.
A primary oocyte gives mount to: four diploid egg cells, one diploid egg cell and three polar bodies, four haploid egg cells or one haploid egg cell and the three polar bodies. Explain it in detail
What event should take place during meiosis for this to happen? What syndrome is characterized by the XYY genotype? What can you learn regarding this syndrome?
Certain human chromosomal aberrations which take place during meiosis result in eggs or sperm with two copies of the X chromosome.
Explain how is sex determined in the grasshoppers? Can you find other illustrations of organisms with a similar system of sex determination?
Once it was found out that codons consisted of three-nucleotide sequences, the specificity of each and every codon could be determined.
If the sequences are read in dissimilar reading frames, explain how does this influence the resulting protein sequence?
Describe the terms RFLPs, VNTRs, and SNPs? What is the relationship among these? Explain how do we use this technology to, for example, recognize paternity?
Name a human congenital disorder which has been attributed to a chromosomal deletion. Explain how common is the disorder? Which human chromosome has suffered a deletion in the disorder?
Describe the concepts of homologous chromosome - diploid and haploid. What features are shared between the two homologous chromosomes?
G-protein linked receptors activate the G proteins by decreasing the strength of GDP binding. This outcomes in rapid dissociation of bound GDP, which is then replaced by the GTP, which is present in
Explain the role of double helix in complimentary base pairing in DNA replication. What does it signify when we state that the two strands of DNA in the double helix are anti-parallel?
By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given questions. a) Write down the mRNA sequence. b) Write down the sequence of the start codon.