Solved: When designing primers it is ideal to have a minimum gc, Biology

+44 141 628 6080
[email protected]

When designing primers it is ideal to have a minimum gc

**When answering, if you could provide a resource to backup your answer please**

When designing primers, it is ideal to have a minimum GC content of 40%. What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered "ideal" in terms of GC content? Explain your answer.

Table 4

Primer 1: TAGCTCAAAGGGTACCTCAG

Primer 2: GATTGGAAGGAACTTCTA

View Complete Question

Solution Preview :

Prepared by a verified Expert

Biology: When designing primers it is ideal to have a minimum gc

Reference No:- TGS02205661

Now Priced at $20 (50% Discount)

Recommended (99%)

Rated (4.3/5)

Have a Question? (oR Write a Review)

Write atleast 100 words!!

Asked Questions

Discuss three ethical guidelines that are important

Identify and discuss three ethical guidelines that are important to consider when designing an 8-week group for adolescents who are referred

Discuss children diagnosed with developmental disabilities

When Min decided to begin his supervised field experience, he applied at a company in his hometown that provided applied behavior analysis

Identify a true statement about validity

Question: Identify a true statement about validity as applied to a test. Multiple choice question

Discussion about gender stereotyping

Prior to your taking this graduate HR law class you had heard of the term "gender stereotyping," but didn't know much about it.

Identify a specific theory of cognitive or moral development

Problem 1: Identify a specific theory of cognitive or moral development, and summarize the major assumptions.

How ensure that the youth understand what study involves

What is another way to say ". It is important to ensure that the youth understand what the study involves, what their participation entails

Why you feel unpleasantly hot and sweaty

Working in the yard, you feel unpleasantly hot and sweaty when you come in the house, so you take a shower and begin to feel better.

Solution Preview :

Prepared by a verified Expert

Biology: When designing primers it is ideal to have a minimum gc

Reference No:- TGS02205661

Have a Question? (oR Write a Review)

Recent Questions Asked Biology

Q : A 4-6 page apa format paper on the spokane falls in spokane

Q : What do the findings tell you about the financial health of

Q : Also determine the residual isi at the output of the

Q : Testing the null hypothesis that the slope of the true

Q : When designing primers it is ideal to have a minimum gc

Q : Close friendship requires an individual to possess a

Q : Determine the least-squares regression line and calculate

Q : A binary pam signal is generated by exciting a

Q : Discuss atlantic slave trade identify middle passageone