Assignment:
Question #1: Neighbors called the police to check on the home of a 55-year-old male who had not been seen taking in his mail or his morning walk for a week. The officers arrived and when no one answered the doorbell, they looked inside the garage from the side window and saw what appeared to be a person in the driver's seat of the car. The vehicle had a vintage car license plate being a restored 34-year-old Ford. The hood was up and tools were placed on a portable workbench next to the car. After gaining entry, they found the body of the homeowner, called 911 but the paramedics finds no sign of life in a cadaver that showed the usual signs of decomposition that appear several days after death. The key was in the ignition and turned in the "on" position.
a. A subsequent inquiry with autopsy showed that the man did not die due to natural causes. While it appeared that the victim was working on his car when he died, what are two clues that the death was intentional? Need Assignment Help?
b. What constitutes the appearance of livor mortis in this case?
c. If instead the man had been found to be alive but unconscious, what is the minimum carbon monoxide blood saturation percentage that would be found on testing?
d. What does it mean when we state that the formation of carbaminohemoglobin induces hypoxia in a victim of carbon monoxide poisoning?
Question #2: An 86-year-old man was brought to the local emergency room with a high fever in a dehydrated state from a local long-term care facility. His weight of 94 lbs. was well below the expected weight for a person with his height and bone frame. Contractures of the extremities were noted. Two stage-four decubitus ulcers were noted (each above the bony prominence of the hip on the right and left sides).
a. Name three issues in the history of this patient as told above that point to a possible case of patient neglect.
b. What was not done to prevent the formation of the ulcers?
c. What blood test can be done to ascertain the nutritional status of this man over the past two months?
d. What can we look for in the medical record that could point to neglect being a cause of this person's current condition?
Question #3: A twenty-year-old Caucasian male was found high up in an oak tree in the local city park. He claimed that he was "Superman" and was trying to decide where to fly next. The first responders attempted to engage him in conversation to distract him from the idea of trying to take flight but he appeared to be quite confused. Firemen were able to extract the man from the tree using their aerial apparatus. When he reached the ground, he began to fight the first responders stating that they were "out to get him." He then tried to run away but was apprehended and taken to the local emergency room. The staff at the ER had to call for assistance to restrain this man once he was given a bed in the ER.
A. Name one drug that could have been taken by this man.
B. Twenty-minutes after admission to the bed in the ER, he suffers a cardiac arrest. Thus, what other drug could possibly be in his system?
C. What factors in this history point to the fact that he probably did not take MDMA (Ecstasy)?
Question #4: A 29-year-old male was pulled over by police after a 10-mile chase. They initially spotted him driving at 90 mph on the local freeway where the speed limit is 65 mph. The driver had difficulty moving to the side of the road and judging where the shoulder of the road was located. He was able to put the car into park but unable to shut the engine off. He appeared to be in distress, sweating profusely and his body weight could be described as "very thin." He was not violent and stated his name when asked and knew that he was speaking to the police. His speech was slurred.
A. What is the substance that this man probably ingested?
B. Judging by his behavior, what is the minimum blood alcohol concentration (BAC) that he had in his system?
C. Assuming he had ingested 5 drinks (of vodka) with no food within the last hour, as of the moment he was arrested, how long will it take for his body to reduce his blood alcohol concentration by 0.075%?
D. In order for a breath test to work, what must occur when the man is breathing out into the testing apparatus?
Question #5: A crime scene investigation was able to collect a minute quantity of DNA found in a saliva sample left on a drinking cup where the stabbing occurred earlier that day. Below you will find data developed at the crime lab that analyzed the status of the noncoding regions in the suspect's DNA.
For this question, please consult the illustration below.
a. At the TH01 locus on both #11 chromosomes, the following number of repeats were found. (The STR sequence at the TH01 locus is AATG).
On one of the two #11 chromosomes, the following number of repeats was found.
AATG AATGAATGAATGAATG
And on the other #11 chromosome, the following number of repeats was found.
AATG AATGAATGAATGAATGAATGAATGAATG
How would these numbers be reported in a DNA profile of the TH01 locus?
b. Why are noncoding regions used in forensic science instead of mapping the coding areas of DNA?
c. In the following diagram, after using PCR to make billions of copies of the noncoding sequence of the VWA locus on chromosome #12, the sample was then added to the well of a gel electrophoresis apparatus. The electric current was turned on and the sample was separated into two separate bands labeled as #1 and #2 below.
Why did the noncoding DNA samples from both #12 chromosomes produce two bands and not one?
d.. If only one band had been produced from the noncoding regions of both #12 chromosomes, what would that have inferred about the number of repeats in the VWA locus on both chromosomes?