The two sequences below represent a normal and a mutated, Biology

+44 141 628 6080
[email protected]

The two sequences below represent a normal and a mutated

The two sequences below represent a normal and a mutated form ofmRNA. Which of the following statements best describes the type of mutation observed?

Normal 5' AUGCCAGCCAGCCCUUCCAGA 3'
Abnormal 5' AUGCCAGCCAGCCCUUCUAGA 3'

a) Point , Silent
b) Point , Missense
c) Point, Nonsense
d) Frame-shift , Insertion
e) Frame-shift, Deletion

Request for Solution File

Ask an Expert for Answer!!

Biology: The two sequences below represent a normal and a mutated

Reference No:- TGS0798023

Expected delivery within 24 Hours

Have a Question? (oR Write a Review)

Write atleast 100 words!!

Asked Questions

Review a social, behavioral, or cultural factor

Bearing in mind that there may be several, choose a social, behavioral, or cultural factor associated with your selected domestic violence

Is lifespan psychologists are unlikely to investigate

Lifespan psychologists are unlikely to investigate both changes as well as consistencies that exist in different individuals'

Discussion about the nature versus nurture

In our readings, we learn more about the nature versus nurture argument. For this discussion, I want you to go in depth a bit more and debate the importance

Problem concerning consensual sexual relationship

Question: Jena and Ben are employees of Big City Electronics. They began to have a consensual sexual relationship.

Discuss social worker working with foster children

You are a social worker working with foster children. You are making a home visit to Katie, age nine, and her foster family.

Describe the results, including any scores

Describe the results, including any scores. Result: E6% Extraverted Action oriented, Outgoing, Expressive, Hands-On S17% Sensing Traditional,

How we perceive objects in the real world

Suppose that a group of researchers would like to explore how we perceive objects in the real world, rather than just in a laboratory

Request for Solution File

Ask an Expert for Answer!!

Biology: The two sequences below represent a normal and a mutated

Reference No:- TGS0798023

Have a Question? (oR Write a Review)

Recent Questions Asked Biology

Q : What is the ploidy of the gametophyte and the sporophyte

Q : What are the genotypes of the parents if a colour blind man

Q : A woman who is colour blind and has bractyldactly marries

Q : Is hairy pinna a sex linked disease if a man has hairy

Q : The two sequences below represent a normal and a mutated

Q : In fruit flies the gene y for yellow body is sex-linked

Q : In drosophila the gene vg for vestigial wing is a

Q : In fruit flies the gene b for black body is recessive to

Q : Double-stranded dna is a cylinder that is 20a wide and 34a