The following dna sequence shows a gene encoding a


The following DNA sequence shows a "gene" encoding a smallpolypeptide. The start codon is AUG and the three "stop" codons are UAA, UAG, and UGA. The promoter region of the DNA is inparetntheses.

5' (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3'
3' (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5'

using the mRNA codon chart, transcribe and translate the"gene" from above.

a) which DNA strand did you choose as the template strand? Topor bottom? Why?

b) mRNA sequence (not including promoter region)=

c) mRNA sequence from start to stop codon=

d) anticodons for each codon=

e) amino acid sequence (including start amino)=

Request for Solution File

Ask an Expert for Answer!!
Biology: The following dna sequence shows a gene encoding a
Reference No:- TGS0802750

Expected delivery within 24 Hours