Discussion:
Single Substitution Polymorphism
1.5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3'
2. Can this sequence be cut by a restriction enzyme?
3. Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?
Write your answer/response in detail with examples and facts and figures using APA style of formatting, size 12, font Times new roman and answer must be single spaced