Question :
Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G, and T.
Write a program that does the following: Create a random DNA string of length 50.
Determine how many times A occurs in the DNA string. Create a dot string which blanks out everything but all the A characters.
Create a rep string where everything is blanked out except where A repeats 1 or more times. Prints the results as follows:
DNA: TGAAAACTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA
dotStr:.. AAAA. .A..A.A. .A...A...... AAA.AA.AAA.....A..A.AAA
repStr:. AAAA.....................AAA.AA.AAA.........AAA
#A: 22