Solved: A what isare the lengths of the newly synthesized strands, Dissertation

+44 141 628 6080
[email protected]

A what isare the lengths of the newly synthesized strands

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:dideoxy); the DNA is danatured, danaturant is removed and primer is annealed, and DNA polymerase is added.

a) What is/are the length(s) of the newly synthesized strand(s) in bases?

b) What is/are the length(s) of the newly synthesized strand(s) in bases if ddATP is excluded?

Please explain the process.

View Complete Question

Solution Preview :

Prepared by a verified Expert

Dissertation: A what isare the lengths of the newly synthesized strands

Reference No:- TGS02916503

Now Priced at $10 (50% Discount)

Recommended (91%)

Rated (4.3/5)

Have a Question? (oR Write a Review)

Write atleast 100 words!!

Asked Questions

Discuss three ethical guidelines that are important

Identify and discuss three ethical guidelines that are important to consider when designing an 8-week group for adolescents who are referred

Identify one antecedent, one behaviour, and one consequence

Sahir is the most active student in your kindergarten class. He tends to be very disruptive when the teacher you work with is teaching the class,

Examine historical literature to the most current period

Examine historical literature to the most current period to see the growth of romanticism and EXISTENTIALISM. any major developments

Provide reasons why working from a person centred

Provide five (5) reasons why working from a person centred, strengths-based positive framework, and providing positive lifestyle strategies can reduce

Is early food experiences can impact development

Early food experiences can impact development over several learning domains, including Social and Emotional Development, Language

How ensure that the youth understand what study involves

What is another way to say ". It is important to ensure that the youth understand what the study involves, what their participation entails

Discuss children diagnosed with developmental disabilities

When Min decided to begin his supervised field experience, he applied at a company in his hometown that provided applied behavior analysis

Solution Preview :

Prepared by a verified Expert

Dissertation: A what isare the lengths of the newly synthesized strands

Reference No:- TGS02916503

Have a Question? (oR Write a Review)

Recent Questions Asked Dissertation

Q : Where do you think the concentration of water molecules is

Q : Using academic scholarly research find an article that

Q : Why dose marx begin capital with commodity what is the

Q : Animal cells how do the differently shaped cells of the

Q : A what isare the lengths of the newly synthesized strands

Q : What is the ploidy of the dna at the end of meiosis i what

Q : Why is it necessary to ask patients with migraine if they

Q : In a critical essay compare and contrast the theory of

Q : What is tension headache what are the symptoms and