Start Discovering Solved Questions and Your Course Assignments
TextBooks Included
Active Tutors
Asked Questions
Answered Questions
1 how does cloning impact both food safety and animal welfare ie what is the relationship of cloning to both food
1 list the steps in the cloning process2 researchers are unable to guarantee that their work with stem cells will
you are a scientist studying the effects of protein xyz on the growth of e coli design an experiment to clone gene xyz
time of entry mapping between a streptomycin-sensitive prototrophic hfr strain and a streptomycin- resistant fminus
dihybrid test crosses are made between each pairwise combination of the three genes c d and e with the following
1 humans have 46 chromosomes whereas chimpanzees gorillas and orangutans have 48 these apes possess two pairs of
use this single strand of nucleic acid 5- atgctatcattgaccttgagttattaa -3 and answer the followingi is this a strand
1 what are the criteria for good primers in a pcr reaction2 describe how you would use site-directed mutagenesis to
1 why is dna evidence more useful as exclusionary evidence than for positive identification of a suspect2 give the dna
if the denaturation step of pcr was omitted what would happen to the pcr processhow is pcr used to determine that a
question 1 explain the two main methods of sequencing the dideoxy sanger method and the basic method of
1 explain the two main methods of sequencing the dideoxy sanger method and the basic method of pyrosequencing2
question 1 - in which we explore gene expressionaexplain how differential gene expression yields a variety of cell
provide research on gene splicing a dna technology that bio-engineers can use to create organisms with traits never
in this experiment we will change the genotype and therefore the phenotype of a bacterium by genetically transforming
1 adescribe in detail how a direct dna repair mechanism worksbcan you think of a way in which you could inhibit this
provide a description of cancer vaccinations including an explanation of the difference between endogenous and
the enzyme telomerase adds dna to the ends of chromosomes why would cancer cells express high levels of
what is dna repairwhat are the mechanisms of dna repairwhat is dna
six mutants in the rii region of phage t4 were independently isolated recombination to produce wild-type progeny
a cross is made between hfr met thi pur x f- met- thi- pur-interrupted-mating studies show that met enters the
1 imagine a population of 10000 humans living on an isolated island every generation an average of one individual is
the theory of recombinant dna technology was enhanced and used in scientific research and now has practical medical
this question involves drosophila order and give the map distance for these three loci involved in this
discuss why rna polymerases are not able to correct base errors during replication or transcription describe the