Start Discovering Solved Questions and Your Course Assignments
TextBooks Included
Solved Assignments
Asked Questions
Answered Questions
an outline of the theory of endosymbiosis with a discussion as to what extent the theory can be used to account for the
the theory of natural selection has been applied to human culture in many different realms for instance there is a
imagine that on your visit to a hypothetical island near a hypothetical continent you observe that one species of
what is the difference between reproductive and therapeutic cloning name one limitation for each technique make sure to
the united nations realizes that at some future date some government will be prepared to pay for human cloning in order
1 explain how information of the sequence of cloned genes can shed light on the function of their coding genes2 explain
engineering a recombinant plasmid dnalike gst- preferably use other than gstto over-express the protein encoded by the
1 a what is meant by the term cloneb why is it important to obtain large quantities of a particular dna sequencec list
i if you have a full-length cdna clone that is a perfect copy of an mrna species you ought to be able to predict the
1 how does cloning impact both food safety and animal welfare ie what is the relationship of cloning to both food
1 list the steps in the cloning process2 researchers are unable to guarantee that their work with stem cells will
you are a scientist studying the effects of protein xyz on the growth of e coli design an experiment to clone gene xyz
time of entry mapping between a streptomycin-sensitive prototrophic hfr strain and a streptomycin- resistant fminus
dihybrid test crosses are made between each pairwise combination of the three genes c d and e with the following
1 humans have 46 chromosomes whereas chimpanzees gorillas and orangutans have 48 these apes possess two pairs of
use this single strand of nucleic acid 5- atgctatcattgaccttgagttattaa -3 and answer the followingi is this a strand
1 what are the criteria for good primers in a pcr reaction2 describe how you would use site-directed mutagenesis to
1 why is dna evidence more useful as exclusionary evidence than for positive identification of a suspect2 give the dna
if the denaturation step of pcr was omitted what would happen to the pcr processhow is pcr used to determine that a
question 1 explain the two main methods of sequencing the dideoxy sanger method and the basic method of
1 explain the two main methods of sequencing the dideoxy sanger method and the basic method of pyrosequencing2
question 1 - in which we explore gene expressionaexplain how differential gene expression yields a variety of cell
provide research on gene splicing a dna technology that bio-engineers can use to create organisms with traits never
in this experiment we will change the genotype and therefore the phenotype of a bacterium by genetically transforming
1 adescribe in detail how a direct dna repair mechanism worksbcan you think of a way in which you could inhibit this