Start Discovering Solved Questions and Your Course Assignments
TextBooks Included
Solved Assignments
Asked Questions
Answered Questions
Select a chromosomal disorder from the March of Dimes Foundation Website. Recognize the disorder and describe how is it expressed in a person and inherited.
Certain trees of the similar species are known to take place with some different chromosome numbers, even although they have similar features.
What would occur if any of the gametes produced were crossed with any of the other gametes produced? (That is, crossing an abnormal gamete with the normal gamete)? Be specific.
Suppose that a single gene controls soybean seed color, and that you already know the nucleotide sequence of the wild type allele.
A primary oocyte gives mount to: four diploid egg cells, one diploid egg cell and three polar bodies, four haploid egg cells or one haploid egg cell and the three polar bodies. Explain it in detail
What event should take place during meiosis for this to happen? What syndrome is characterized by the XYY genotype? What can you learn regarding this syndrome?
Certain human chromosomal aberrations which take place during meiosis result in eggs or sperm with two copies of the X chromosome.
Explain how is sex determined in the grasshoppers? Can you find other illustrations of organisms with a similar system of sex determination?
Once it was found out that codons consisted of three-nucleotide sequences, the specificity of each and every codon could be determined.
If the sequences are read in dissimilar reading frames, explain how does this influence the resulting protein sequence?
Describe the terms RFLPs, VNTRs, and SNPs? What is the relationship among these? Explain how do we use this technology to, for example, recognize paternity?
Name a human congenital disorder which has been attributed to a chromosomal deletion. Explain how common is the disorder? Which human chromosome has suffered a deletion in the disorder?
Describe the concepts of homologous chromosome - diploid and haploid. What features are shared between the two homologous chromosomes?
G-protein linked receptors activate the G proteins by decreasing the strength of GDP binding. This outcomes in rapid dissociation of bound GDP, which is then replaced by the GTP, which is present in
Explain the role of double helix in complimentary base pairing in DNA replication. What does it signify when we state that the two strands of DNA in the double helix are anti-parallel?
By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given questions. a) Write down the mRNA sequence. b) Write down the sequence of the start codon.
Write down the processes and phases of human embryogenesis? Explain how does a fetus develop from a one-cell fertilized egg?
Illustrate, define and describe the single break chromosomes: a) One arm of one chromosome. b) One arm of two chromosomes.
What genes are comprised with the regulation mammalian "biological clock" causing it to maintain a consistent 24 hour cycle? Please explain the possible pathways comprised in this phenomenon?
I understand the utilization of processed food products needed some adaptation on the human genome level. Animals don't consume sterile alcoholic beverages and milk is only consumed by the young.
Explain DNA sequencing with reference to the cloning of a DNA fragment in bacteriophages M13 based cloning vector.
The promoters for mRNA encoding early proteins in viruses such as T4 have a different sequence than the promoters for mRNA encoding late proteins in the same virus.
Whenever constructing cDNA libraries it is much significant to copy the whole of an mRNA into cDNA. One way to try and make sure that the 5' end of an mRNA is represented in a cDNA copy is to use "c
Write down the components of an operon? What significant regulator is not part of the actual operon? Know how operons are classified and how each kind works (Inducible, Repressible, Positive and Neg
The promoters for mRNA encoding early proteins in viruses similar to T4 have a dissimilar sequence than the promoters for mRNA encoding late proteins in the same virus.