Start Discovering Solved Questions and Your Course Assignments
TextBooks Included
Solved Assignments
Asked Questions
Answered Questions
what is the difference between isomers and epimers what is an example of each during digestion disaccharides like
suppose your lab instructor asked you to make quantitative determinations of the followingtotal protein concentration
this reaction is catalyzed in the cytosol of the liver by glutamate y- semialdehyde dehydrogenase how would this enzyme
using the henderson-hasselbalch equation calculate the net average charge on the amino acid cysteine in solution at ph
what are the three stages of glucose catabolism in oxidative cells what are the products of each stage which products
what is the difference between configuration and conformation of three-dimensional
what are the major differences between aerobic and anaerobic glycolysis in terms of starting substrate products and
suppose a cell develops a mutation in its uracil dna glycosylase what aberrant nucleotide will accumulate in the dna of
describe the key experiments that supported the semi-conservative model of dna replication in e
given the following dna template non-coding sequence3 - ccgtctccatcatgttgtacatgcgggcgctgtgcgcgggcccggcccg - 5nbspa
the pentose phosphate cycle has an oxidative and a nonoxidative section and these are presented as both playing
why is carnitine necessary for the metabolism of fatty acids what are ketone bodies and why are they
why phosphoenolpyruvate pep can be used for substrate-level phosphorylation to transfer a phosporyl group from pep to
you know that fats are metabolized into acetyl coa which can enter the cacanbspa rat is fed stearic acid that is
describe the methodologies used for sanger sequencing and compare them to the methods used for shotguns sequencing of
the volume of an automobile air bag was 748 l when inflated at 30 degc with 778 g of nitrogen n2 gasnbspwhat was the
how do the majority of proteins that exist outside cells get outside cells explain
if a farmer buys ammonia and adds it to a field the amount remaining in the field after the crop is harvested is always
after 24 hours of starvation the glycogen reserves of the liver are exhausted but there are still relatively large
biosignaling and the kegg databaseexercise goalslearn how to use the kegg databasedescribe the relationships between
describe how the structure of dna allows it to be copied and what enzyme performs this functiondescribe how a
for periodic acid-schiff experiment1 is there any difference in staining between the nucleus and cytoplasm why2 is the
in fast green stain for proteins for protazoa experiment is there a difference in the intensity of staining between the
thinking of the citric acid cycle within a cell in what steps of the cycle are the exergonic reactions located why
what is a second messenger name the second messenger for glucagon and explain how it exerts its regulation of glycogen