1. A SNP marker has 3 alleles in a population: A, T and C. The population frequencies of the 3 alleles are pA = 0.2, pT = 0.5 and pC = 0.3, respectively. Assuming random mating (Hardy-Weinberg equilibrium), the frequency of A/T genotypes is______ , the frequency of A/C genotypes is______ and the frequency of T/C genotypes is______ .
2. A boy who is born to healthy parents that are siblings (brother and sister) is an example of______ mating and may be at higher risk for______ diseases.
3. A point mutation that changes a codon from GAU to GAA is an example of a ________ mutation.
A. synonymous
B. missense
C. nonsense
D. harmful
E. silent
4. The shorthand notation for a normal female karyotype is ________.
A. 47,XXY
B. 48,XXYY
C. 46,XY
D. 44,XX
E. 46,XX
5. A chromosome with a centromere located in the middle of the chromosome roughly equidistant from the two telomeres is ________.
A. metacentric
B. submetacentric
C. telocentric
D. acrocentric
E. eccentric
6. The ________ technique can be used to collect a sample of fetal cells for genetic testing using only a blood sample from a pregnant woman.
A. chorionic villi sampling
B. amniocentesis
C. fetal cell sorting
D. nuclear fission
E. none of the above.
7. Which of the following is NOT a DNA repair mechanism that exists in humans?
A. Photoreactivation repair
B. Double-stranded break repair
C. Excision repair
D. Mismatch repair
8. An oncogene can arise by a ______ of a ______.
9. The mature mRNA transcript for a gene with one exon is originally
5' AUGAGGGAAUCCCCUAGGUGA 3'
and a mutation inserts an additional G nucleotide after position 7 in the DNA sequence so that the mutated gene produces the modified mature mRNA transcript
5' AUGAGGGGAAUCCCCUAGGUGA 3'
The amino acid sequence of the protein coded by the original gene is ______ and the amino acid sequence of the protein coded by the mutated gene is ______ . This is an example of a ______ mutation. If 3 G nucleotides were instead inserted after position 7 it would be an example of a ______ mutation.