Problem:
Recombinant DNA molecules are DNA molecules formed by laboratory methods of genetic recombination to bring together genetic material from multiple sources, creating sequences that would not otherwise be found. The letters C, G, A, and T represent nucleotides, the molecules that when joined together, make up the structural units of DNA. Simulate an experiment by searching for the pattern "GAATTC ". Your code will search for "GAATTC " in the original DNA strand, which is "CTAGAGAATTCCTGA" below. Split that strand into two pieces and place the new DNA, which is "TGATA" below, into the original strand. The new strand should be inserted before the strand being searched for, "GAATTC", to increase the original strand. The user must enter the original strand, the new strand to be inserted, and the sequence to be searched for. Your dialog must look like this, with three inputs and the longer strand as the output:
Original: CTAGAGAATTCCTGA
New: TGATA
Search: GAATTC
Increased: CTAGATGATAGAATTCCTGA
Hints:
- Assume all inputs are uppercase letters GTAC only. No other letters, no spaces, ...
- Assume the search string is in the original strand. We will not enter invalid inputs