Problem:
In the human gene for the beta chain of hemoglobin, the oxygen-carrying protein in the red blood cells, the first 30 nucleotides in the protein-coding region are shown here: 3' TACCACGTGGACTGAGGACTCCTCTTCAGA 5'
Required:
Question 1: What is the sequence of the partner strand?
Question 2: If the DNA duplex of this gene were transcribed from left to right, what is the base sequence of the RNA across this part of the coding region?
Question 3: What is the sequence of amino acids in this part of the beta-globin polypeptide chain?